yajR

Information for yajR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 443889-444398 + CDS yajQ EG13613 orf; hypothetical protein 444526-445896 - CDS yajR EG13614 putative transport protein 446039-446929 - CDS cyoE EG10182 protoheme IX farnesyltransferase (haeme O biosynthesis)

Reported regulatory sites for yajR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.862 445954-445970 R ctcga AATATTTACTAAAAAAT ccgca - 0 - 0.766 445978-445994 R tctta GCATTAGAAACATATCC ctctc - 0 - 0.762 445941-445962 R attta CTAAAAAATCCGCATGTTTACC ccatt - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back