ybaB

Information for ybaB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 491316-493247 + CDS dnaX EG10245 DNA polymerase III; tau and gamma subunits; DNA elongation factor III 493300-493629 + CDS ybaB EG11100 orf; hypothetical protein 493629-494234 + CDS recR EG10834 recombination and repair

Reported regulatory sites for ybaB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.759 493248-493266 tttga TCGTAAGCACAGCTTACGT tcgtc - 0 - 0.646 493276-493295 catcc TTAACGTGATTGAGAGAGAA accta - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back