ybaC

Information for ybaC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 497279-498241 + CDS hemH EG10431 ferrochelatase: final enzyme of heme biosynthesis 498238-499197 - CDS ybaC EG11101 putative lipase (EC 3.1.1.-) 499349-500653 + CDS gsk EG11102 inosine-guanosine kinase

Reported regulatory sites for ybaC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.468 499208-499231 R tggtt CCTTACAATGACGTAATTTGAAAG gagtt - 0 - 0.306 499251-499271 R agttt CAATATCAGCAGGCGGGATCG cattt - 0 - 0.223 499302-499317 R gcggc GAATGTTAACACAATC tgacg - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back