ybaD

Information for ybaD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 431536-432135 - CDS yajI EG12874 orf; hypothetical protein 432226-432675 + CDS ybaD EG11320 orf; hypothetical protein 432679-433782 + CDS ribD EG11321 bifunctional pyrimidine deaminase/reductase in pathway of riboflavin synthesis

Reported regulatory sites for ybaD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.905 432148-432169 ttatc TCAAAAGCGTTGCGCCTTTGTT gtatc - 0 - 1.272 432136-432156 agcat CGATCCTTTATCTCAAAAGCG ttgcg - 0 - 0.790 432177-432194 atcgt CAGTTCAGGGTAAAATAG atttc - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back