ybaE

Information for ybaE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 464076-464771 - CDS ybaX EG13252 orf; hypothetical protein 464836-466536 - CDS ybaE EG13217 orf; hypothetical protein 466624-467454 + CDS cof EG13216 orf; hypothetical protein

Reported regulatory sites for ybaE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.003 466563-466584 R tgata TATACGGAAGTAATAGTGAATA gttaa - 0 - 1.205 466539-466561 R aatag TTAAATAATATTGTTCCGGGTTT atatg - 0 - 1.022 466589-466607 R gttaa TGGTGATTGAGTATCACCT gatat - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back