ybaE
 
Information for ybaE, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
464076-464771
-
CDS
orf; hypothetical protein
464836-466536
-
CDS
ybaE
orf; hypothetical protein
466624-467454
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for ybaE:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
5.003
466563-466584 R
tgata TATACGGAAGTAATAGTGAATA gttaa
-
0
-
1.205
466539-466561 R
aatag TTAAATAATATTGTTCCGGGTTT atatg
-
0
-
1.022
466589-466607 R
gttaa TGGTGATTGAGTATCACCT gatat
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back