ybaL

Information for ybaL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 499349-500653 + CDS gsk EG11102 inosine-guanosine kinase 500786-502462 - CDS ybaL EG12623 putative transport protein 502700-503920 - CDS fsr EG13268 fosmidomycin resistance protein

Reported regulatory sites for ybaL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.241 502637-502653 R cagtc GCCATAAGCCTTTCCTC tgtta - 0 - 2.220 502549-502568 R aattc AATAATTATTCATGAACATC atcaa - 0 - 1.711 502682-502701 R agact GATTTCATTGCAGCCAAAGG caaac - 0 - 1.711 502587-502606 R tccgt GCTTTTTTTGCAGCTAATTC cattt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back