ybaO

Information for ybaO, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 466624-467454 + CDS cof EG13216 orf; hypothetical protein 467520-468065 + CDS ybaO EG13218 putative LRP-like transcriptional regulator 468095-469867 + CDS mdlA EG11622 ATP-binding component of a transport system

Reported regulatory sites for ybaO: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.943 467455-467476 aataa CGAGATCCCTTCCAGCACCGGG caatt - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back