ybaP

Information for ybaP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 505827-506306 - CDS ybaK EG12454 orf; hypothetical protein 506510-507304 - CDS ybaP EG13244 putative ligase 507388-507783 + CDS ybaQ EG13245 orf; hypothetical protein

Reported regulatory sites for ybaP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.497 507313-507334 R gcgcg CTAGCATGATATTTCACAAAGG gaggt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back