ybaR

Information for ybaR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 507388-507783 + CDS ybaQ EG13245 orf; hypothetical protein 508099-510603 - CDS ybaR EG13246 putative ATPase 510865-511797 + CDS ybaS EG13247 putative glutaminase

Reported regulatory sites for ybaR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.152 510650-510670 R tcttg ACCTTCCCCTTGCTGGAAGGT ttaac - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.524 510640-510655 R tgctg GAAGGTTTAACCTTTA tcaca - 0 - 1.392 510715-510731 R tgatg CAAATCGAGCCGATTTT ttaat - 0 - 1.392 510622-510638 R tttat CACAGCCAGTCAAAACT gtctt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back