ybaS

Information for ybaS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 508099-510603 - CDS ybaR EG13246 putative ATPase 510865-511797 + CDS ybaS EG13247 putative glutaminase 511800-513092 + CDS ybaT EG13248 putative amino acid/amine transport protein

Reported regulatory sites for ybaS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.599 510604-510627 gacat AAAACACTCCTTTAAGACAGTTTT gactg - 0 - 0.192 510827-510850 tgagg AATTACCTCCCGCATCTATAAAAA ggagt - 0 -

Critical MAP values: p=0.01 5.55 p=0.05 3.60 p=0.1 3.00 p=0.2 2.32

Click here to go back