ybaV

Information for ybaV, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 461139-463010 + CDS ybaU EG13249 putative protease maturation protein 463161-463532 + CDS ybaV EG13250 orf; hypothetical protein 463626-464024 + CDS ybaW EG13251 orf; hypothetical protein

Reported regulatory sites for ybaV: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.884 463056-463077 caaga AAAGGTCGCTTTCGCGGCCTTT tccat - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.194 463133-463150 gattc CACTGTTAACAAACAAGG agaaa - 0 - 3.284 463077-463097 gcctt TTCCATTTCTGAACATTGCCA tttgt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back