ybbB
 
Information for ybbB, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
528869-529276
-
CDS
orf; hypothetical protein
529356-530450
-
CDS
ybbB
putative capsule anchoring protein
530519-531445
-
CDS
putative transcriptional regulator LYSR-type
 
Reported regulatory sites for ybbB:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA SP ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.138
530496-530519 R
agtta AAAATCAAGTTTCCTTGCGCGTTG gcgcg
-
0
-
2.138
530462-530485 R
taaaa TAGCGCGCAAGCTGATTTGAGGTT cactt
-
0
-
 
Critical MAP values:
p=0.01
6.09
p=0.05
4.94
p=0.1
4.37
p=0.2
3.74

Click here to go back