ybbU

Information for ybbU, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 531675-532157 + CDS ybbT EG13615 orf; hypothetical protein 532235-533050 + CDS ybbU EG13616 putative regulator 533140-534921 + CDS gcl EG11583 glyoxylate carboligase

Reported regulatory sites for ybbU: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.415 532181-532197 ataag ATAAACTAATTGTTCAT tgttt - 0 - 0.642 532218-532233 gtagg TCGGAGTTAACGTAGG tatga - 0 - 0.527 532156-532178 tgcgt GACGCCTGCAACCGACTTGCATA agata - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back