ybdG

Information for ybdG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 601182-602558 + CDS pheP EG10708 phenylalanine-specific transport system 602639-603886 - CDS ybdG EG12620 putative transport 603994-604647 - CDS nfnB EG20151 oxygen-insensitive NAD(P)H nitroreductase

Reported regulatory sites for ybdG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.085 603953-603976 R gggca TCTGCCCGGCTATTTCCTCTCAGA ttctc - 0 - 1.335 603920-603943 R cctga TTTGCATAACCCTGTTTCAGCCGT catca - 0 - 1.132 603907-603927 R ctgtt TCAGCCGTCATCATAGGCTGC tgttg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back