ybdH

Information for ybdH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 629117-631222 + CDS cstA EG10167 carbon starvation protein 631612-632700 - CDS ybdH EG12692 putative oxidoreductase 632809-633969 + CDS ybdL EG13531 putative aminotransferase

Reported regulatory sites for ybdH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.127 632723-632746 R tggca ATCAAGACGTTTAGATGTCTAAAT aaaac - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.406 632740-632758 R gatgc TAGTATTTGGCAATCAAGA cgttt - 0 - 2.756 632755-632773 R aaggc ACTATAACACGATGCTAGT atttg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back