ybdO

Information for ybdO, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 634572-635792 - CDS ybdN EG13533 orf; hypothetical protein 635939-636841 - CDS ybdO EG13534 putative transcriptional regulator LYSR-type 637050-637856 - CDS dsbG EG13535 thiol:disulfide interchange protein

Reported regulatory sites for ybdO: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.774 636931-636950 R ttaga AAAACTTAATCCTGAGTTAA gcaaa - 0 - 1.552 636943-636960 R ctgtg CTATTTTAGAAAAACTTA atcct - 0 - 0.725 636855-636876 R gtgaa TATATCATGGAAGAAAAATATA accgg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back