ybdS

Information for ybdS, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 643420-644226 - CDS rna EG10856 RNase I; cleaves phosphodiester bond between any two nucleotides 644340-645803 - CDS ybdS EG13538 putative a membrane protein 645854-646732 - CDS citG EG13539 orf; hypothetical protein

Reported regulatory sites for ybdS: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.317 645812-645833 R ataaa TTTGGAAATATTAATTTTCGGA gaacc - 0 - 0.502 645834-645853 R tttaa TTATTTAAGCACTTGATAAA tttgg - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back