ybeJ
 
Information for ybeJ, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
685152-685892
-
CDS
glutamate/aspartate transport system permease
686062-686970
-
CDS
ybeJ
putative periplasmic binding transport protein
687220-688236
-
CDS
IS5 transposase
 
Reported regulatory sites for ybeJ:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.810
687027-687048 R
caata AAGTTGCAGACGATAACAACAC aaaca
-
0
-
1.269
687041-687057 R
aacac TGCACAATAAAGTTGCA gacga
-
0
-
1.216
686984-687003 R
tccat GCGTTCTTAACGCAGAAGAT aaagg
-
0
-
 
Critical MAP values:
p=0.01
6.66
p=0.05
5.31
p=0.1
4.59
p=0.2
3.95

Click here to go back