ybeZ

Information for ybeZ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 691097-691564 - CDS ybeY EG13655 orf; hypothetical protein 691561-692640 - CDS ybeZ EG13656 putative ATP-binding protein in pho regulon 692754-694178 - CDS yleA EG13657 orf; hypothetical protein

Reported regulatory sites for ybeZ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.670 692685-692702 R cccca TCTTTATTGCAATGCTTG cgcct - 0 - 1.269 692650-692672 R ttcct GTGGCGTGAATAATTTCCTTATA ggccg - 0 - 0.989 692728-692747 R tctca GGCCTGCCGTTCCGGTGGGC cttgt - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back