ybgR

Information for ybgR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 782389-783108 + CDS pnuC EG11700 required for NMN transport 783105-784046 - CDS ybgR EG13662 putative transport system permease protein 784160-784540 - CDS b0753 EG13663 putative homeobox protein

Reported regulatory sites for ybgR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.632 784117-784140 R caata ATGGGAGAGCGGAGTCTCTCCCTT ttaat - 0 - 2.521 784083-784101 R acttc TAAAAGCAGTATGATGTCA taaag - 0 - 0.456 784060-784076 R aaagt TAAGTGAGAATAATTAA gggat - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back