ybhQ

Information for ybhQ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 822959-823720 - CDS ybhP EG13672 orf; hypothetical protein 823853-824263 + CDS ybhQ EG13673 orf; hypothetical protein 824225-825331 - CDS ybhR EG13674 orf; hypothetical protein

Reported regulatory sites for ybhQ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 9.914 823787-823804 cggtc TTACGGAATTTTCCGTAA agttc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.979 823740-823762 tgcct CTTATCTCATTGAAATAGTGTAG tcggc - 0 - 4.387 823755-823774 tgaaa TAGTGTAGTCGGCGTCACAA aaagg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back