ybiF

Information for ybiF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 847631-848134 - CDS dps EG11415 global regulator; starvation conditions 848433-849320 - CDS ybiF EG12134 putative transmembrane subunit 849673-850188 + CDS ompX EG12135 outer membrane protein X

Reported regulatory sites for ybiF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.689 849553-849576 R ccatt TCATGTAACAGAACGTTTCCATAC accgc - 0 - 2.723 849634-849655 R tgtga TTCAAATAAGTCCTAAGTTTTA aatat - 0 - 2.723 849456-849477 R attca TCCAGATTATTCCTAATCACCA gacta - 0 - 2.415 849437-849454 R accag ACTAATGATTCCATCAAT cctgg - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back