ybiH

Information for ybiH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 828197-829195 - CDS b0795 EG13315 putative membrane protein 829195-829878 - CDS ybiH EG12406 putative transcriptional regulator 830095-831459 + CDS rhlE EG11235 putative ATP-dependent RNA helicase

Reported regulatory sites for ybiH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.984 829879-829902 R cataa TCTTAATCAATCATTTGATTAAGA atgga - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.549 829969-829990 R agcag TTTTTGTGACGCAGCGCATAAA ttatc - 0 - 5.336 830011-830032 R ggaaa ATGACAAAAACCACAATGTCAT gaggg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back