ybiP

Information for ybiP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 849673-850188 + CDS ompX EG12135 outer membrane protein X 850237-851820 - CDS ybiP EG13321 putative enzyme 851894-852163 + CDS b0816 - orf; hypothetical protein

Reported regulatory sites for ybiP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.885 851840-851860 R cttga CGCCAGGGTAAGCACATGGCG tttgt - 0 - 3.038 851852-851868 R tattg ACCCTTGACGCCAGGGT aagca - 0 - 0.202 851821-851838 R ggcgt TTGTTACGATAGTGGCAT atgaa - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back