ybjG

Information for ybjG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 881199-881957 - CDS deoR EG10223 transcriptional repressor for deo operon; tsx; nupG 882015-882611 - CDS ybjG EG13676 orf; hypothetical protein 882896-884128 + CDS cmr EG13696 proton motive force efflux pump

Reported regulatory sites for ybjG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.332 882867-882887 R atttc TTCGCCAATAATAATCGCGCA gagtt - 0 - 1.280 882850-882866 R gcgca GAGTTTAATAAAAGCGC agcta - 0 - 1.280 882750-882766 R tcttt AAGTTTTATTTAACCTA tgccc - 0 - 1.123 882687-882710 R ttgag GGAAATAAGACGATGCCGCTTTAC ccagt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back