yceL

Information for yceL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1122630-1123277 - CDS grxB EG12688 glutaredoxin 2 1123341-1124579 - CDS yceL EG13878 orf; hypothetical protein 1124785-1125369 + CDS rimJ EG10851 acetylation of N-terminal alanine of 30S ribosomal subunit protein S5

Reported regulatory sites for yceL: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.904 1124651-1124673 R acata TTTGATAAAAACTCTCTATCAAA gcgac - 0 - 4.322 1124622-1124640 R gtttt GATAAAAAAATATTGTCCC cgaag - 0 - 2.589 1124690-1124710 R ctgtg AAAAGTCCAAAATGCCATTTT ctgca - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back