yceP

Information for yceP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1118691-1119809 - CDS solA EG12669 sarcosine oxidase-like protein 1119924-1120178 - CDS yceP EG14335 orf; hypothetical protein 1120465-1120710 - CDS dinI EG12670 damage-inducible protein I

Reported regulatory sites for yceP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.037 1120236-1120252 R ggtat ACTGAAGTTGCTTCAGA taaaa - 0 - 3.746 1120430-1120447 R ttttt TGCCGGGTCGCCCCGGCT ttttt - 0 - 3.077 1120257-1120278 R aaatt CGGTGAATACCCTTACTTATTG gtata - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back