ycgB

Information for ycgB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1234161-1234880 + CDS fadR EG10281 negative regulator for fad regulon; and positive activator of fabA 1234932-1236464 - CDS ycgB EG11516 putative sporulation protein 1236794-1238092 + CDS dadA EG11407 D-amino acid dehydrogenase subunit

Reported regulatory sites for ycgB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.975 1236745-1236768 R ataca GTAAAAGAATAATAATCTAATCAC atctt lrp 23 - 2.912 1236711-1236731 R aactc AGTTGAAAATATTATTCAACA tgcgg lrp 14 - 1.636 1236494-1236514 R atgct TGAAATGAGGTGCTCCACACA gagag lrp 19 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back