ychK

Information for ychK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1287897-1288355 - CDS ychJ EG12119 orf; hypothetical protein 1288429-1289373 + CDS ychK EG12120 orf; hypothetical protein 1289465-1290478 + CDS hnr EG12121 Hnr protein

Reported regulatory sites for ychK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.067 1288357-1288378 acaca AATAATCTCCCTGGAAACAATA acggc - 0 - 1.922 1288407-1288428 gcact ATGTTAACCGAGCAGTAGCGAT gtggc - 0 - 0.586 1288390-1288406 tatta ACCGCCTGAGTAGCACT atgtt - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back