ycjG

Information for ycjG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1386329-1386835 - CDS tpx EG12672 thiol peroxidase 1386912-1387919 + CDS ycjG EG13228 putative muconate cycloisomerase I (EC 5.5.-.-) 1387894-1388682 - CDS ycjI EG13906 putative carboxypeptidase

Reported regulatory sites for ycjG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.909 1386849-1386865 ttcct GTTTACATATAGTTAAC gtcac - 0 - 2.535 1386876-1386897 accta GTTTATGCTAACTGTCAATAAC acagc - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back