ydaO

Information for ydaO, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1407535-1408908 + CDS dbpA EG10210 ATP-dependent RNA helicase 1409037-1409972 - CDS ydaO EG13357 orf; hypothetical protein 1410024-1411259 - CDS b1345 EG13358 putative transposase

Reported regulatory sites for ydaO: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.087 1410008-1410024 R tcgta GTTGCAAAGTTTGCCCC caatt - 0 - 1.625 1409975-1409996 R gcccc ATTTAGTACCAGAGAACTGAAA taatg - 0 - 1.378 1409991-1410007 R gcccc CAATTTGCCCCATTTAG tacca - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back