yddG

Information for yddG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1543762-1544052 - CDS b1472 EG13783 putative outer membrane porin protein 1544312-1545193 - CDS yddG EG12713 orf; hypothetical protein 1545425-1548472 + CDS fdnG EG11227 formate dehydrogenase-N; nitrate-inducible; alpha subunit

Reported regulatory sites for yddG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.415 1545332-1545348 R aaatc AAAAAGAACATCTGTTT gccac fnr 6 - 0.989 1545223-1545238 R ctata AAATTCAGCTTAATTT ttaac - 0 - - 0.713 1545342-1545365 R ctgaa TCTTTTTGCGCGAAATCAAAAAGA acatc fnr 22 -

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back