ydeB

Information for ydeB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1615052-1616242 + CDS ydeA EG11636 putative resistance / regulatory protein 1616267-1616932 - CDS ydeB EG11637 orf; hypothetical protein 1617201-1617578 + CDS marR EG11435 multiple antibiotic resistance protein; repressor of mar operon

Reported regulatory sites for ydeB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.537 1617122-1617143 R ttcac ATTAGTTGCCCTGGCAAGTAAT tagtt marR 22 - 5.537 1617087-1617108 R gggga TAATATTGCCCAGGCAAGTATA agtca marR 22 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.586 1617159-1617176 R ggaat AATTTCATTGAACAGATC gctgg - 0 - 1.282 1617041-1617060 R gatgc CACGTTTTGCTAAATCGGTT caagt marA 14 - 1.282 1617021-1617040 R cggtt CAAGTTTTGTTCAATGCGAT gcaag fis 12 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back