ydeJ

Information for ydeJ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1622129-1622521 - CDS ydeI EG11644 orf; hypothetical protein 1622797-1623315 + CDS ydeJ EG11645 orf; hypothetical protein 1623359-1625404 - CDS dcp EG10212 dipeptidyl carboxypeptidase II

Reported regulatory sites for ydeJ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.454 1622546-1622562 ttggt TTGACTTATTAAGTCTG gttgc - 0 - 2.758 1622701-1622719 ttttc AGAATAATCGGATTTATAT gtttg - 0 - 1.000 1622568-1622591 gttgc TATTTTTATAATTGCCAAATAAGA atatt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back