ydfG

Information for ydfG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1623359-1625404 - CDS dcp EG10212 dipeptidyl carboxypeptidase II 1625541-1626287 + CDS ydfG EG12345 putative oxidoreductase 1626376-1627062 + CDS ydfH EG13820 orf; hypothetical protein

Reported regulatory sites for ydfG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.257 1625502-1625523 ccgtg CTATGTTATTGACACACAAAAG cgttg - 0 - 1.734 1625466-1625482 aatct TGCAATCCAGTATTACC cgctc - 0 - 0.703 1625519-1625540 cacac AAAAGCGTTGAGGAACAGTGAG atgat - 0 -

Critical MAP values: p=0.01 5.40 p=0.05 4.29 p=0.1 3.77 p=0.2 3.19

Click here to go back