ydfG
 
Information for ydfG, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
1623359-1625404
-
CDS
dipeptidyl carboxypeptidase II
1625541-1626287
+
CDS
ydfG
putative oxidoreductase
1626376-1627062
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for ydfG:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: HI PA ST EC VC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
2.257
1625502-1625523
ccgtg CTATGTTATTGACACACAAAAG cgttg
-
0
-
1.734
1625466-1625482
aatct TGCAATCCAGTATTACC cgctc
-
0
-
0.703
1625519-1625540
cacac AAAAGCGTTGAGGAACAGTGAG atgat
-
0
-
 
Critical MAP values:
p=0.01
5.40
p=0.05
4.29
p=0.1
3.77
p=0.2
3.19

Click here to go back