yeaF

Information for yeaF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1862806-1863660 - CDS b1781 EG13491 putative an aldehyde reductase 1863750-1864496 - CDS yeaF EG13492 orf; hypothetical protein 1864932-1866866 + CDS yeaG EG13493 orf; hypothetical protein

Reported regulatory sites for yeaF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.861 1864871-1864894 R taaga GCCGTTCATATGAATAGTAGAGGC tcccg - 0 - 3.116 1864695-1864714 R tttca ATGGCATATCAACAACTCAT ccata - 0 - 3.116 1864673-1864692 R catcc ATAAATTTTGCATAATTAAT gtaaa - 0 - 2.951 1864587-1864604 R cagga AAATTAAACAGTTACTTT aaaaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back