yeaH

Information for yeaH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1864932-1866866 + CDS yeaG EG13493 orf; hypothetical protein 1866979-1868262 + CDS yeaH EG13494 orf; hypothetical protein 1868409-1869884 + CDS yeaI EG13495 orf; hypothetical protein

Reported regulatory sites for yeaH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.896 1866897-1866920 ccggg CCTACAACGACAGCGAACCGTGGG cctga - 0 REP134 (5) 0.750 1866949-1866965 tagca TACAGTTGGCAAATGTA gtacg - 0 REP134 (6) - 0.430 1866876-1866896 cctgg CCCGGTACACATGTTACCGGG cctac - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back