yeaX

Information for yeaX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1882689-1883813 + CDS yeaW EG13509 orf; hypothetical protein 1883869-1884834 + CDS yeaX EG13510 putative diogenase beta subunit 1884888-1886015 - CDS rnd EG10858 RNase D; processes tRNA precursor

Reported regulatory sites for yeaX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.828 1883820-1883843 gacat CGGCGGCGGTATTTTCCGCCGCTG ggctg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Critical MAP values: p=0.01 4.78 p=0.05 3.24 p=0.1 2.72 p=0.2 2.16

Click here to go back