yecK

Information for yecK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1952602-1955049 - CDS bisZ EG13276 biotin sulfoxide reductase 2 1955056-1956156 - CDS yecK EG13277 putative cytochrome C-type protein 1956544-1956984 - CDS cutC EG12956 copper homeostasis protein

Reported regulatory sites for yecK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.595 1956341-1956359 R ttatg GGATTTAAATTACTAAAAC tgata - 0 - 1.411 1956323-1956342 R ctaaa ACTGATAAATATATATTCTA aatag - 0 - 1.411 1956193-1956212 R attcg TTGTATATTTAATTATACAA tgatt - 0 - 0.447 1956463-1956486 R ctgca ATTTCAACAGGGGCCTTTTTTTAT ccctg - 0 -

Critical MAP values: p=0.01 3.18 p=0.05 2.36 p=0.1 2.00 p=0.2 1.60

Click here to go back