yedD
 
Information for yedD, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2004179-2005666
+
CDS
cytoplasmic alpha-amylase
2005700-2006113
-
CDS
yedD
orf; hypothetical protein
2006300-2007505
+
CDS
putative transport system permease protein
 
Reported regulatory sites for yedD:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
6.651
2006274-2006293 R
aatgt AGCCTCTGAACTCAGAAGGT ttgaa
-
0
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.222
2006212-2006231 R
tattt TCGGGGTAATAATTCACAAA aataa
-
0
-
3.222
2006143-2006162 R
cgaca TCAGGGCTTTAATGCCACAA tcctc
-
0
-
2.110
2006115-2006136 R
cctct TTTCTTCTCATGCAGGACGAAT gatga
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back