yehV

Information for yehV, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2210979-2212664 - CDS yehU EG12007 putative 2-component sensor protein 2212886-2213617 + CDS yehV EG12008 putative transcriptional regulator 2213765-2214496 - CDS yehW EG12009 putative transport system permease protein

Reported regulatory sites for yehV: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.651 2212720-2212743 ttaac TTTCTTTGAACTCTTGCAGAAAAA tgaga - 0 - 4.852 2212812-2212833 acaaa AAACGGGCAAAACTACCTGGTT cgcaa - 0 - 3.737 2212844-2212860 aactg CGTCTAAAGTTAAACCG ggacc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back