yehZ

Information for yehZ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2215420-2216577 - CDS yehY EG12011 putative transport system permease protein 2216584-2217501 - CDS yehZ EG12012 putative transport system permease protein 2217712-2220009 - CDS bglX EG12013 beta-D-glucoside glucohydrolase; periplasmic

Reported regulatory sites for yehZ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.953 2217681-2217701 R tagta AGGGCGCGACGTTTGCGCCCT ttgta - 0 - 1.679 2217529-2217550 R tatgc TTTTCTCTTAATTCGCTGAAAA caaca - 0 - 0.606 2217603-2217618 R gcctc TTAAGTATTTATCTGA ttctg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back