yeiO
 
Information for yeiO, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2260385-2261515
-
CDS
PTS system; fructose-specific IIA/fpr component
2261883-2263064
+
CDS
yeiO
putative transport
2263215-2264042
+
CDS
putative elongation factor
 
Reported regulatory sites for yeiO:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
7.596
2261530-2261550
ctctt GCTGAATTGAAACGATTCAGC ctcta
fruR
16
-
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
4.652
2261602-2261617
atcgc GCTGAAACGTTTCAAG aaagc
fruR
16
-
2.570
2261840-2261858
gacaa GCAGCGTAAACTCCGCGTC ttcct
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back