yeiP

Information for yeiP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2261883-2263064 + CDS yeiO EG12034 putative transport 2263215-2264042 + CDS yeiP EG12035 putative elongation factor 2264265-2265731 + CDS yeiQ EG12036 putative oxidoreductase

Reported regulatory sites for yeiP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.046 2263160-2263183 cagac TTTCGGTCGCAGTGGCGAGGTGAA aattt - 0 - 0.549 2263128-2263143 cgcac ATTTCAGCGCTGGCTT gtaag - 0 - 0.549 2263146-2263161 cttgt AAGCCTGCACAGACTT tcggt - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back