yeiP
 
Information for yeiP, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2261883-2263064
+
CDS
putative transport
2263215-2264042
+
CDS
yeiP
putative elongation factor
2264265-2265731
+
CDS
putative oxidoreductase
 
Reported regulatory sites for yeiP:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.046
2263160-2263183
cagac TTTCGGTCGCAGTGGCGAGGTGAA aattt
-
0
-
0.549
2263128-2263143
cgcac ATTTCAGCGCTGGCTT gtaag
-
0
-
0.549
2263146-2263161
cttgt AAGCCTGCACAGACTT tcggt
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back