yfaO

Information for yfaO, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2361753-2362316 - CDS b2250 EG14088 orf; hypothetical protein 2362574-2362999 + CDS yfaO EG13275 orf; hypothetical protein 2363038-2363640 - CDS ais EG13155 protein induced by aluminum

Reported regulatory sites for yfaO: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.039 2362395-2362411 agtca CTTATTGTAACTAAATA cttct - 0 - 0.857 2362329-2362348 aaatt CCCAAAGCTGCGGGATTGTA ctgcc - 0 - 0.820 2362408-2362425 aacta AATACTTCTTAAATAATT aaatg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back