yfdC
 
Information for yfdC, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2462272-2463027
-
CDS
lipoprotein precursor
2463321-2464253
+
CDS
yfdC
putative transport
2464329-2464403
+
tRNA
Arginine tRNA5
 
Reported regulatory sites for yfdC:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.432
2463075-2463097
catga CGGAACGATACCGTATCCGCCTG tttag
-
0
-
3.058
2463118-2463136
ttgta ACAGCACGTCAACTGATGT ccaga
-
0
-
2.798
2463048-2463068
ttttt ATGGCTTATGCAGTTTGCCAT ccatg
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back