yfeN

Information for yfeN, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2522065-2522898 - CDS xapA EG20250 xanthosine phosphorylase 2523147-2523911 + CDS yfeN EG13160 putative sugar hydrolase 2523950-2524876 - CDS yfeR EG14159 putative transcriptional regulator LYSR-type

Reported regulatory sites for yfeN: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.077 2522984-2523006 acgca TTCAATAGCGATTCGATATCGAT ggatt - 0 - 4.077 2523009-2523031 gatgg ATTTATATCTTTTCTCTATTAAT ccacg - 0 - 3.174 2523102-2523123 ccact TTATTAAGCAATCTACTAATAA cgatc - 0 - 2.348 2522959-2522981 cggct CTTACCAATACACTTTTCTCACG cattc - 0 - 2.348 2523034-2523056 aatcc ACGGTAAAAACTGTATTGGCGAT attaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back