yffG
 
Information for yffG, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2580923-2581498
-
CDS
orf; hypothetical protein
2581566-2583545
-
CDS
yffG
putative oxidoreductase; Fe-S subunit
2583751-2585451
+
CDS
sensor for nitrate reductase system; protein histidine kinase (acts on NarP and narL)
 
Reported regulatory sites for yffG:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.554
2583569-2583585 R
ctcat ATAAAGAATAAGGTTTT tacaa
-
0
-
2.450
2583553-2583576 R
agaat AAGGTTTTTACAACCAAAAAAGAA ggtcg
-
0
-
2.284
2583619-2583639 R
tattc TGGGCACATGAACATTGCCGA ttccc
-
0
-
 
Critical MAP values:
p=0.01
7.30
p=0.05
6.05
p=0.1
5.26
p=0.2
4.60

Click here to go back