yfhG
 
Information for yfhG, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2685489-2686823
-
CDS
putative 2-component transcriptional regulator
2686813-2687526
-
CDS
yfhG
putative alpha helix protein
2687691-2689181
-
CDS
putative 2-component sensor protein
 
Reported regulatory sites for yfhG:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
0.722
2687529-2687551 R
ccact GGGATAGGCTTTAAGTCTGGTGA atatg
-
0
RSA5 (12)
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back