yfhH
 
Information for yfhH, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
2695935-2696507
-
CDS
orf; hypothetical protein
2696707-2697627
+
CDS
yfhH
orf; hypothetical protein
2697683-2697943
+
CDS
orf; hypothetical protein
 
Reported regulatory sites for yfhH:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.630
2696676-2696692
ctaac TGGAATTTTTAATTCAT ggcaa
-
0
-
1.452
2696586-2696609
tctgg ACTGAAACATCCTGATTAATTTTC gctac
-
0
-
 
Critical MAP values:
p=0.01
7.59
p=0.05
6.45
p=0.1
5.76
p=0.2
5.04

Click here to go back